rsg1  (Novus Biologicals)

Journal: Nature Communications

Article Title: The human ciliopathy protein RSG1 links the CPLANE complex to transition zone architecture

doi: 10.1038/s41467-025-61005-8

Figure Lengend Snippet: A Structure of mouse CPLANE complex, Wdpcp, Intu, Fuz, and Rsg1 (PDB: 7Q3E). RSG1 allelic variants highlighted in red and GTP in the nucleotide pocket indicated ( B , D , F ) Pedigree maps and prominent features for ciliopathy indicated patients. ( C , E , G ) Structure of mouse Rsg1 (PDB 7q3e) with corresponding human residues altered by ciliopathy variants highlighted in red (see also Supplementary Fig. ).

Article Snippet: RPE1 RSG1 knockout cell lines were generated using two single guide RNAs synthesized by Synthego (sgRNA cut site 1: UUGCCCUAGGGCUGCUUGAG, sgRNA cut site 2: CCCACUCACCGGUGGUCUCG).

Techniques:

Journal: Nature Communications

Article Title: The human ciliopathy protein RSG1 links the CPLANE complex to transition zone architecture

doi: 10.1038/s41467-025-61005-8

Figure Lengend Snippet: A En face in vivo imaging of a Xenopus multiciliated cell with axonemes labelled by membrane-RFP (blue) and basal bodies labeled with centrin-BFP (green). B – E En face images of single MCCs showing Rsg1 basal body localization for control, and S72P (=human A76P), G114E (=human G118E), and D184W (=human R188W) variants. ( b’ – e’ ) merged channels showing Rsg1(green) with centrin (magenta), scale bar = 5 μm. F Graph showing mean ± standard deviation of normalized GFP-Rsg1 basal body fluorescence (see “Methods”). N > 25 cells in 5 embryos across 3 experiments for all conditions. N values and statistic can be found in Supplementary Dataset .

Article Snippet: RPE1 RSG1 knockout cell lines were generated using two single guide RNAs synthesized by Synthego (sgRNA cut site 1: UUGCCCUAGGGCUGCUUGAG, sgRNA cut site 2: CCCACUCACCGGUGGUCUCG).

Techniques: In Vivo Imaging, Membrane, Labeling, Control, Standard Deviation, Fluorescence

Journal: Nature Communications

Article Title: The human ciliopathy protein RSG1 links the CPLANE complex to transition zone architecture

doi: 10.1038/s41467-025-61005-8

Figure Lengend Snippet: A – F High magnification en face images showing IFT43 (green) localization at apical basal bodies labeled by centrin (magenta). A – C Control, Rsg1 KD, and rescue of KD with WT Rsg1. D – F Failure of rescue by indicated variant alleles. Scale bar= 1 μm. G Graph showing mean ± standard deviation of normalized IFT43-GFP basal body fluorescence. N > 21 cells in 6 embryos across 2 experiments for all conditions. N values and statistics can be found in Supplementary Dataset .

Article Snippet: RPE1 RSG1 knockout cell lines were generated using two single guide RNAs synthesized by Synthego (sgRNA cut site 1: UUGCCCUAGGGCUGCUUGAG, sgRNA cut site 2: CCCACUCACCGGUGGUCUCG).

Techniques: Labeling, Control, Variant Assay, Standard Deviation, Fluorescence

Journal: Nature Communications

Article Title: The human ciliopathy protein RSG1 links the CPLANE complex to transition zone architecture

doi: 10.1038/s41467-025-61005-8

Figure Lengend Snippet: Spectral counts are shown for selected proteins in APMS with WT Rsg1 versus the Rsg1(T69N) mutant. Interactors are grouped by function. Examples of non-specific interactors are provided at the bottom. Full data table can be found in Supplementary Dataset .

Article Snippet: RPE1 RSG1 knockout cell lines were generated using two single guide RNAs synthesized by Synthego (sgRNA cut site 1: UUGCCCUAGGGCUGCUUGAG, sgRNA cut site 2: CCCACUCACCGGUGGUCUCG).

Techniques: Mutagenesis

Journal: Nature Communications

Article Title: The human ciliopathy protein RSG1 links the CPLANE complex to transition zone architecture

doi: 10.1038/s41467-025-61005-8

Figure Lengend Snippet: A Alphafold3 prediction of the structure of two human FUZ-RSG1 heterodimers interacting with one Fam92a homodimer. Colors indicate monomers as indicated. B 90-degree rotation from ( B ). C Increased magnification view of ( C ) showing the RGS1-FAM92A interaction (after removal of FUZ and one copy of FAM92A for clarity).

Article Snippet: RPE1 RSG1 knockout cell lines were generated using two single guide RNAs synthesized by Synthego (sgRNA cut site 1: UUGCCCUAGGGCUGCUUGAG, sgRNA cut site 2: CCCACUCACCGGUGGUCUCG).

Techniques:

Journal: Nature Communications

Article Title: The human ciliopathy protein RSG1 links the CPLANE complex to transition zone architecture

doi: 10.1038/s41467-025-61005-8

Figure Lengend Snippet: A PAE Plot for the interaction of full-length human RSG1 and FAM92A monomers; arrow indicates region of Rsg1 interaction with the C-terminus of Fam92. B Structure of RSG1 monomer in complex with FAM92A monomer, with colors indicating PlDDT. C PAE Plot for the interaction of full-length RSG1 with the C-terminal 83 amino acids of FAM92A; arrow indicates region of Rsg1 interaction. D Structure corresponding to C, with colors indicating PlDDT. E PAE Plot indicates no interaction between full-length RSG1 with the C-terminal 83 amino acids of FAM92A; arrow indicates region of Rsg1 interaction. F Structure corresponding to E, note very poor PlDDT scores at the region of “interface.”.

Article Snippet: RPE1 RSG1 knockout cell lines were generated using two single guide RNAs synthesized by Synthego (sgRNA cut site 1: UUGCCCUAGGGCUGCUUGAG, sgRNA cut site 2: CCCACUCACCGGUGGUCUCG).

Techniques:

Journal: Nature Communications

Article Title: The human ciliopathy protein RSG1 links the CPLANE complex to transition zone architecture

doi: 10.1038/s41467-025-61005-8

Figure Lengend Snippet: A , B , D , E High magnification en face images of MCCs apical basal bodies labeled by centrin (magenta) and Fam92b (green) scale bar = 1 μm. C , F Graphs of normalized Fam92b basal body fluorescence. C Graph showing Fam92b fluorescence levels after KD of Rsg1. F Graph showing Fam92b fluorescence levels after over expression of Rsg1 T65N. G Transverse 3D projection of centrin (magenta) and Fam92b (green), scale bar = 5 μm. H Graph shows the fluorescence intensity of Fam92b on basal bodies at different depths starting from apical (docked) and several μm from the apical surface. N > 25 cells in 6 embryos across 3 experiments for all conditions. All graphs show showing mean ± standard deviation. N values and statistics can be found in Supplementary Dataset .

Article Snippet: RPE1 RSG1 knockout cell lines were generated using two single guide RNAs synthesized by Synthego (sgRNA cut site 1: UUGCCCUAGGGCUGCUUGAG, sgRNA cut site 2: CCCACUCACCGGUGGUCUCG).

Techniques: Labeling, Fluorescence, Over Expression, Standard Deviation

Journal: Nature Communications

Article Title: The human ciliopathy protein RSG1 links the CPLANE complex to transition zone architecture

doi: 10.1038/s41467-025-61005-8

Figure Lengend Snippet: A – C Human RPE1 cells stained for ARL13B (green) and TubAc (magenta) as markers in control and RSG1 crispant cells. scale bar = 10 µm D – F Imaging of FAM92A (cyan) fluorescence at the transition zone CEP192 (yellow) in RPE1 cells with mutated Rsg1. Insets show three indicated cilia from the panels above. G Percentage ciliation using ARL13B (green) and TubAc (magenta) positive cells in RSG1 mutants. H Mean ± standard deviation of normalized FAM92 at the transition zone, ciliated cells marked in orange and non-ciliated in blue. N > 80 for all conditions. N values and statistics can be found in Supplementary Dataset .

Article Snippet: RPE1 RSG1 knockout cell lines were generated using two single guide RNAs synthesized by Synthego (sgRNA cut site 1: UUGCCCUAGGGCUGCUUGAG, sgRNA cut site 2: CCCACUCACCGGUGGUCUCG).

Techniques: Staining, Control, Imaging, Fluorescence, Standard Deviation

Journal: Nature Communications

Article Title: The human ciliopathy protein RSG1 links the CPLANE complex to transition zone architecture

doi: 10.1038/s41467-025-61005-8

Figure Lengend Snippet: A – C Human RPE1 cells stained for the TZ protein NPHP1, the basal body protein Cep192, and the cilia marker ARL13B. Scale bar = 10 μm. G Graph shows mean ± standard deviation of normalized Nphp1 fluorescence at the transition zone for indicated genotypes. D – F Nphp1(green) fluorescence at basal bodies labeled in tub(magenta) in Intu or Fuz mutant mouse embryo fibroblasts. Scale bar = 10 μm. H Graph shows mean ± standard deviation of normalized Nphp1 fluorescence at the basal body in controls and Intu or Fuz mutants. N > 52 for all conditions. N values and statistics can be found in Supplementary Dataset .

Article Snippet: RPE1 RSG1 knockout cell lines were generated using two single guide RNAs synthesized by Synthego (sgRNA cut site 1: UUGCCCUAGGGCUGCUUGAG, sgRNA cut site 2: CCCACUCACCGGUGGUCUCG).

Techniques: Staining, Marker, Standard Deviation, Fluorescence, Labeling, Mutagenesis